View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_544 (Length: 209)
Name: NF10829A_low_544
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_544 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 20 - 209
Target Start/End: Complemental strand, 38093119 - 38092934
Alignment:
| Q |
20 |
ttcaaggaaattttgcaacaagaacaaatattcctggatcccacaatttgaatgaagatcttgttctcatagacgtatcaaattgtccgaaggaatccca |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38093119 |
ttcaaggaaattttgcaactagaacaaatattcgtggatcccacaatttgaatgaagatcttgttctcatagacgtatcgaattgtccgaaggaatccca |
38093020 |
T |
 |
| Q |
120 |
ttgtttccttttt-ccaatatttctcattcaagaaaacaacatatagggtttctttccttctgcaccctttgagtcaattctgcatgcttt |
209 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38093019 |
ttgtttccttttttccaatatttctcattcaagaaaacaacatatagggtttcttg-----tgcaccctttgagtcaattctgcatgcttt |
38092934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University