View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_554 (Length: 206)
Name: NF10829A_low_554
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_554 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 22 - 191
Target Start/End: Original strand, 46912871 - 46913044
Alignment:
| Q |
22 |
atcttggattggatcattggatacactcgtaataatacaatcccacccatca----atcttgtgtcataactcaatttgatgatactagcacacaaaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
46912871 |
atcttggattggatcattggatacactc--aataatacaatcccacccatcaatcaatcttgtgtcataactcaatttgatgaaactagcacacaaaaga |
46912968 |
T |
|
| Q |
118 |
cctcaacttgataaaaagaacttactat--nnnnnnnnnngtttcaggttgattaaatattactcatagttgatgt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46912969 |
cctcaacttgataaaaagaacttactattaaaaaaaaacagtttcaggttgattaaatattactcatagttaatgt |
46913044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University