View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_557 (Length: 205)
Name: NF10829A_low_557
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_557 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 20 - 187
Target Start/End: Complemental strand, 43875994 - 43875827
Alignment:
| Q |
20 |
aaagggtcggtgccgttttctcaagtgtcaaatttgagtgctcaaaactatgaggaaggtgttgatggtgatgctgttgatatggctgaaatgccacctc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43875994 |
aaagggtcggtgccgttttctcaagtgtcaaatttgagtgctcaaaactatgaggaaggtgttgatggtgatgctgttgatatggctgaaatgccacctc |
43875895 |
T |
|
| Q |
120 |
agagtttgattgctgagttggctagtggattaagggaaagattgggacttaatcttttcaatgttgat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43875894 |
agagtttgattgctgagttggctagtggattaagggaaagattgggacttaatcttttcaatgttgat |
43875827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University