View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_562 (Length: 203)
Name: NF10829A_low_562
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_562 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 6 - 203
Target Start/End: Complemental strand, 49375829 - 49375631
Alignment:
| Q |
6 |
aagttgaataagcagttaaatannnnnnnaagataaatgactaatttgggnnnnnnn--gaagttaaatgacatgttaaaactttaattaaggtaaaaga |
103 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49375829 |
aagttgaataagcagttaaatatttttt-aagataaatgactaatttgggaaaaaagaagaagttaaatgacatgttaaaactttaattaaggtaaaaga |
49375731 |
T |
|
| Q |
104 |
gaagttgtgtggttttgccttgaacgtgcactctgtgttgtttaaaatttagaaaatgcagtgtgagatgagcaaaacacacgttgcttggtatgggatg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49375730 |
gaagttgtgtggttttgccttgaacgtgcactctgtattgtttaaagtttagaaaatgcagtgtgagatgagcaaaacacacgttgcttggtatgggatg |
49375631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University