View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_563 (Length: 202)
Name: NF10829A_low_563
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_563 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 74 - 125
Target Start/End: Original strand, 43285430 - 43285481
Alignment:
| Q |
74 |
acatgggggtggcagtgaggcctcacgtgggtatatctgacaccaaggcatg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43285430 |
acatgggggtggcagtgaggcctcacgtgggtatatctgacaccaaggcatg |
43285481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University