View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_569 (Length: 201)
Name: NF10829A_low_569
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_569 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 21 - 169
Target Start/End: Complemental strand, 31922965 - 31922818
Alignment:
| Q |
21 |
atcacatggacatggcgtagaactctcagcttagttgaaagaagcacgttcagttcttctattgtgnnnnnnnnaaggaaatgcttaatctttacttgaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||| |
|
|
| T |
31922965 |
atcacatggacatggcgtagaactctcagcttagttgaaagaagcacgttcagttcttctattttgtttttttta-ggaaatgcttaatctttacttgaa |
31922867 |
T |
 |
| Q |
121 |
ggacgtgcataggactagattttgttgaaaataatgtattatcatgtgt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31922866 |
ggacgtgcataggactagattttgttgaaaataatgtattttcatgtgt |
31922818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University