View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_73 (Length: 395)
Name: NF10829A_low_73
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_73 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 7 - 383
Target Start/End: Original strand, 54746313 - 54746689
Alignment:
| Q |
7 |
tcctggtggtgccatggtcctaacacttattggcagagatgagcaaaatgaacttatgaatgcatgggttgtcattggcatggcactcaatgacatggcc |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54746313 |
tcctagtggtgccatggtcctaacacttattggcagagatgagcaaaatgaacttatgaatgcatgggttgtcattggcatggcactcaatgacatggcc |
54746412 |
T |
|
| Q |
107 |
gcagtggtaattaatcaaacaacattcaactttagaaagttcacttgattgattaaaacaagctttaatttgttcataatttatatttcattgatcaa-c |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
54746413 |
gcagtggtaattaatcaaacaacattcaactttagaaagttcacttgattgattaaaacaagctttaatttgttcataatgtatatttcattgatcaacc |
54746512 |
T |
|
| Q |
206 |
ccgctcatataannnnnnnnaaaaatagatctaatcttataaaaatttcataaaattctaaattatttgatacttttaccatatcactttatttcaattt |
305 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54746513 |
ccgctcatataa-tttttttaaaaatagatctaatcttataaaaatttcataaaattctaaattatttgatacttttaccatatcactttatttcaattt |
54746611 |
T |
|
| Q |
306 |
acttatatcatttaaaatataagtaaatttgtattattaaatcacattaattactatgttaatattattacatatatt |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54746612 |
acttatatcatttaaaatataagtaaatttgtattattaaatcacattaattactatgttaatattattacatatatt |
54746689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University