View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10829A_low_93 (Length: 372)
Name: NF10829A_low_93
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10829A_low_93 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 175 - 372
Target Start/End: Complemental strand, 7177115 - 7176918
Alignment:
| Q |
175 |
gtcagcaacatctccatcatcctaggacaacaaccttacattggtttagcaacaaatgcatgtccacgaaaaggtgattcaaaatcaatccgaggttaca |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7177115 |
gtcagcaacatctccatcatcctaggacaacaaccttatattggtttagcaacaaatgcatgtccacgaaaaggcgattcaaaatcaatccgaggttaca |
7177016 |
T |
|
| Q |
275 |
catgtaacggcaaaactcaaacatgccaagcatacctcaccttcagaactcaaccaatttactcctcagtttcaacaatatcatcattactaggctca |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7177015 |
catgtaacggcaaaactcaaacatgccaagcatacctcaccttcagaactcaaccaatttactcctcagtttcaacaatatcatcattactaggctca |
7176918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 16 - 125
Target Start/End: Complemental strand, 7177277 - 7177168
Alignment:
| Q |
16 |
aaaagagtcctatcgtaaaataattggatttatgctcctagtatgtaacaaaagactcgatttatatattgcattattacaccccattctctgcaagcaa |
115 |
Q |
| |
|
||||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7177277 |
aaaagagtcatatcataaaataattggctttatgctcctagtatgtaacaaaagactcgatttatatattgcattattacaccccattctctgcaagcaa |
7177178 |
T |
|
| Q |
116 |
taacaatgca |
125 |
Q |
| |
|
|||||||||| |
|
|
| T |
7177177 |
taacaatgca |
7177168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University