View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10830_low_4 (Length: 209)
Name: NF10830_low_4
Description: NF10830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10830_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 105 - 192
Target Start/End: Complemental strand, 26869327 - 26869240
Alignment:
| Q |
105 |
tttagttgagtatgaggcggaaaatgaatctcacagttcagaacctgcgtgcgtgcaagatgacgttctgttggttgatactttagtt |
192 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26869327 |
tttagttgagtatgaggcagaaaatgaatctcacagttctgaacttgcgtgtgtgcaagatgacgttctgttggttgatactttagtt |
26869240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 93
Target Start/End: Original strand, 13430070 - 13430147
Alignment:
| Q |
16 |
aatgaggtggaagaattcttgatcgatggtataaaattttctattaggcttgtggaagatttagtgtttggtatagca |
93 |
Q |
| |
|
|||||||||||||| |||||||| | ||||| |||||||||||| | ||||||||||| |||| |||||| ||||| |
|
|
| T |
13430070 |
aatgaggtggaagatttcttgataggtggtacgaaattttctattcgacttgtggaagacttagattttggtttagca |
13430147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University