View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10830_low_4 (Length: 209)

Name: NF10830_low_4
Description: NF10830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10830_low_4
NF10830_low_4
[»] chr4 (1 HSPs)
chr4 (105-192)||(26869240-26869327)
[»] chr7 (1 HSPs)
chr7 (16-93)||(13430070-13430147)


Alignment Details
Target: chr4 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 105 - 192
Target Start/End: Complemental strand, 26869327 - 26869240
Alignment:
105 tttagttgagtatgaggcggaaaatgaatctcacagttcagaacctgcgtgcgtgcaagatgacgttctgttggttgatactttagtt 192  Q
    |||||||||||||||||| |||||||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||||||||||    
26869327 tttagttgagtatgaggcagaaaatgaatctcacagttctgaacttgcgtgtgtgcaagatgacgttctgttggttgatactttagtt 26869240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 93
Target Start/End: Original strand, 13430070 - 13430147
Alignment:
16 aatgaggtggaagaattcttgatcgatggtataaaattttctattaggcttgtggaagatttagtgtttggtatagca 93  Q
    |||||||||||||| |||||||| | |||||  |||||||||||| | ||||||||||| ||||  |||||| |||||    
13430070 aatgaggtggaagatttcttgataggtggtacgaaattttctattcgacttgtggaagacttagattttggtttagca 13430147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University