View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_high_12 (Length: 363)
Name: NF10831_high_12
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 16 - 354
Target Start/End: Original strand, 4092949 - 4093287
Alignment:
| Q |
16 |
caggttttggtgattcagtatgcaaaaggcctagcagattgcgtaccgttgaatactgctggatggactatatgtgtgctggttagcgctctttcatggg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4092949 |
caggttttggtgattcagtatgcaaaaggcctagcagattgcgtaccgttgaatactgctggatggactatatgtgtgctggttagcgctctttcatggg |
4093048 |
T |
 |
| Q |
116 |
tatttgaatggatcttgaagagtcttccagttattatgcacaccaattatgctacaagctccgaacctgcagggaccgagttattatttgcgccaattat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4093049 |
tatttgaatggatcttgaagagtcttccagttattatgcacaccaattatgctacaagctccgaacctgcagggaccgagttattatttgcgccaattat |
4093148 |
T |
 |
| Q |
216 |
gcttcagcatcagaacctgcggaatctaccagtttaaacacagaatgattttgttgattgacatatgcagccaacatgatttctgttgagctgactcatc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4093149 |
gcttcagcatcagaacctgcggaatctaccagtttaaacacagaatgattttgttgattgacatatgcagccaacatgatttctgttgagctgactcatc |
4093248 |
T |
 |
| Q |
316 |
attgagttagttatgacatagaaggattggctttcatct |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4093249 |
attgagttagttatgacatagaaggattggttttcatct |
4093287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University