View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_high_23 (Length: 300)
Name: NF10831_high_23
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 24 - 280
Target Start/End: Original strand, 21611600 - 21611856
Alignment:
| Q |
24 |
tatttgatcctaggggacaaaccattcaccaatggaacaagattttcttggtagcatgtttaatttctttgtttgtggatcctctcttcttttatttgcc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21611600 |
tatttgatcctaggggacaaaccattcaccaatggaacaagattttcttggtagcatgtttaatttctttgtttgtggatcctctcttcttttatttgcc |
21611699 |
T |
 |
| Q |
124 |
aatagttcaagatgaagtgtgcattgatattggaatagcagttgaagttttcctcataattattagatcaattgcggacgtcttttacgtcattcacatt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21611700 |
aatagttcaagatgaagtgtgcattgatattggaatagcagttgaagttttcctcataattattagatcaattgcggacgtcttttacgtcattcacatt |
21611799 |
T |
 |
| Q |
224 |
ttcatgaggtttcatacggcatatgttgcaccttcttctagggtttttgggagagga |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21611800 |
ttcatgaggtttcatacggcatatgttgcaccttcttctagggtttttgggagagga |
21611856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 24 - 280
Target Start/End: Complemental strand, 40513662 - 40513406
Alignment:
| Q |
24 |
tatttgatcctaggggacaaaccattcaccaatggaacaagattttcttggtagcatgtttaatttctttgtttgtggatcctctcttcttttatttgcc |
123 |
Q |
| |
|
|||| ||||||||||||||| ||| || | ||||||||||| || || |||||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
40513662 |
tattagatcctaggggacaactcatacatcgttggaacaagatatttttagtagcatgtttagtttctttgtttgtggatccactgttcttttatttgcc |
40513563 |
T |
 |
| Q |
124 |
aatagttcaagatgaagtgtgcattgatattggaatagcagttgaagttttcctcataattattagatcaattgcggacgtcttttacgtcattcacatt |
223 |
Q |
| |
|
| | ||| ||| ||||| |||||||||||||||| | | |||||||| | |||| | || |||||||| ||| || | |||||| | |||| ||| |
|
|
| T |
40513562 |
agtggttagagaagaagtttgcattgatattggaaaaactcttgaagttattctcacagttgttagatcatttggagatttgttttacatagttcagatt |
40513463 |
T |
 |
| Q |
224 |
ttcatgaggtttcatacggcatatgttgcaccttcttctagggtttttgggagagga |
280 |
Q |
| |
|
| |||| ||||| ||| || |||||||| |||||||| | ||||||||| |||||| |
|
|
| T |
40513462 |
tgtatgaagtttcgtacagcttatgttgctccttcttccaaggtttttggtagagga |
40513406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University