View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_high_55 (Length: 220)
Name: NF10831_high_55
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_high_55 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 26348856 - 26349058
Alignment:
| Q |
1 |
acaaatactatcaaaagagaatcttttgaaaacatcttgcaaatcaaaaacaacttggtttaggttttggttttggagtagagggatgagtcgattttcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26348856 |
acaaatactatcaaaagagaatcttttgaaaacatcttgcaaatcaaaaacaacttggtttaggttttggttttggagtagagggatgagtcgattttcg |
26348955 |
T |
|
| Q |
101 |
atttcgttgttgacaacttcaaaggcaaatgatcttacggattgtttgttgagttctaaacttgccatcttcttttgaaatttccataaatcaccatcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26348956 |
atttcgttgttgacaacttcaaaggcaaatgatcttatggattgtttgttgagttctaaacttgccatcttcttttgaaatttccataaatcaccatcca |
26349055 |
T |
|
| Q |
201 |
cgt |
203 |
Q |
| |
|
||| |
|
|
| T |
26349056 |
cgt |
26349058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University