View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_high_61 (Length: 202)
Name: NF10831_high_61
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_high_61 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 47889846 - 47889656
Alignment:
| Q |
1 |
ccttccaattctctccgtcgtcgacctcccctctctcctccaagctgtcgctgtcgacactcttgtttccgccgctcaatctctcgctctcgtatttctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47889846 |
ccttccaattctctccgtcgtcgacctcccctctctcctccaagctgtcgccatcgacactcttgtttccgccgctcaatctctcgctctcgtatttctc |
47889747 |
T |
|
| Q |
101 |
atttccccctttaattacaatcttttaattttactttgcattttatccagtttactctgtaagcatgttgtggaaattagggtctctgctt |
191 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||||||| |
|
|
| T |
47889746 |
attttcccctttaattacaatcttttaattttactttgcattttatccagtttactctgtaagcatgttgtgggaattaggttttctgctt |
47889656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University