View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_20 (Length: 333)
Name: NF10831_low_20
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 16 - 327
Target Start/End: Complemental strand, 42255565 - 42255254
Alignment:
| Q |
16 |
taaagggtggaaggtactttccactagtgtctcttattagataaagaggatcaagaatgtatgaagcagcccaagcagggtggtagtttttcctaaacct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42255565 |
taaagggtggaaggtactttccactagtgtctcttattagataaagaggatcaagaatgtatgaagcagcccaagcagggtggtagtttttcctaaacct |
42255466 |
T |
 |
| Q |
116 |
tctttcaatcaacttttctattgctgcttctgcaatgttgaatttggaacaccaatctttcacttttgtcctcaactcattccaaaggagaaggcattgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42255465 |
tctttcaatcaacttttctattgctgcttctgcaatgttgaatttggaacaccaatctttcacttttgtcctcaactcattccaaaggagaaggcattgt |
42255366 |
T |
 |
| Q |
216 |
ccaactaatggcttttctgtctcaatttccttagccatgtctttcaccaatttagccaaactgtgtacagcttctaaatcattccaaaaaccgatgtcgc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42255365 |
ccaactaatggcttttctgtctcaatttccttagccatgtctttcaccaatttagccaaactgtgtacagcttctaaatcattccaaaaaccgatgtcgc |
42255266 |
T |
 |
| Q |
316 |
gattcatctcac |
327 |
Q |
| |
|
|| |||| |||| |
|
|
| T |
42255265 |
gaatcatgtcac |
42255254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University