View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_23 (Length: 319)
Name: NF10831_low_23
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 29 - 174
Target Start/End: Complemental strand, 31279285 - 31279140
Alignment:
| Q |
29 |
gaccatacaagtttgaaagttattaaagcaaataaaacatagccactaaaccccaagagagaaaaagaatacaccctcaaaatgccttctaaaaacttgt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31279285 |
gaccatacaagtttgaaagttattaaagcaaataaaacatagccactaaaccccaagagagaaaaagaatacaccctcaaaatgccttctaaaaacttgt |
31279186 |
T |
 |
| Q |
129 |
tgatatactcaatatagttgtacatgaaacttagtttaaactacaa |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31279185 |
tgatatactcaatatagttgtacatgaaacttagtttaaactacaa |
31279140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 184 - 304
Target Start/End: Complemental strand, 31276923 - 31276801
Alignment:
| Q |
184 |
aatttaagttcggtatagatctcgattg--gagtcaaagaccctttaactgcgtgaacgtgtgtagtcggttattgcatggagtgttggtttaaaataca |
281 |
Q |
| |
|
||||||| |||||||||||| || |||| ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31276923 |
aatttaaattcggtatagatttctattgaagagtcaaagaccctttaactgcgtgaatgtgtctagtcggttattgcatggagtgttggtttaaaataca |
31276824 |
T |
 |
| Q |
282 |
cagagtcacaaattaattataat |
304 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
31276823 |
cacagtcacaaattaattataat |
31276801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University