View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_26 (Length: 308)
Name: NF10831_low_26
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 21 - 275
Target Start/End: Original strand, 11739462 - 11739724
Alignment:
| Q |
21 |
aaaacatatagaatataactacttcacaaagtcacgtggacatannnnnnnaatcgttcatactttcatgtcaataaccatgaacatatgaacatttatt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11739462 |
aaaacatatagaatataactacttcacaaagtcatgtgggcatatttttttaatcgttcatactttcatgtcaataaccatgaacatatgaacatttatt |
11739561 |
T |
|
| Q |
121 |
attcccctnnnnnnnnctatgaatctctataaatgtccattattttgacagggctctgatgtgcacgcgtttctcaagtttcgtttgtgcatagttgtag |
220 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11739562 |
attcccctaaaaaaaactatgaatctctataaatgtccattattttgacagggctctgatgtgcacgcgtttctcaagtttcgtttgcgcatagttgtag |
11739661 |
T |
|
| Q |
221 |
caacta--------nnnnnnngaggagttgtagcaacttgtaaagtaccttatctctaaagtc |
275 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11739662 |
caactacaactatttttttgagaggagttgtagcaacttgtaaagtaccttttctctaaagtc |
11739724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University