View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_31 (Length: 292)
Name: NF10831_low_31
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 4 - 278
Target Start/End: Complemental strand, 41005841 - 41005568
Alignment:
| Q |
4 |
attagattgtatcgtccacagaaaatatgcatcttgatgcagactctttgatatgttaagtatgtctaacaataaagtgaaaatataagggtttaaagtt |
103 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41005841 |
attagattgtgtcgtccacagaaaatatgcattttgatgcagactctttgatatgttaagtatgtctaacagtaaagtgaaaatataagggtttaaagtt |
41005742 |
T |
 |
| Q |
104 |
tacccctcggtatatttttattgtcatgggaaaatattttatgactccatcttgtatccttacactagtagaggtttcccatacatatcattgataactc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41005741 |
tacccctcggtatatttttattgtcatgggaaaatattttatgactccatcttgtatcctcacactagtagaggtttcccatacatatcattgataactc |
41005642 |
T |
 |
| Q |
204 |
aaatataggcaatcttaaccnnnnnnnnctttcttttctccaaggctttccacaaaatccactatatcacatgcc |
278 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41005641 |
aaatataagcaatcttaacc-tttttttctttcttttctccaaggctttccacaaaatccactatatcacatgcc |
41005568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University