View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_33 (Length: 279)
Name: NF10831_low_33
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 270
Target Start/End: Original strand, 38695817 - 38696069
Alignment:
| Q |
18 |
acaaatagtgatgcatatacgaataatttctttgttttttacagttgattttagtggagtggtgattaatttagctcatatttttacttgcattagtttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38695817 |
acaaatagtgatgcatatacgaataatttttttgttttttacagttgattttagtggagtggtgattaatttagcttatatttttacttgcattagtttc |
38695916 |
T |
 |
| Q |
118 |
gaatcttggcaattgtccgaatgtataagttatataggttgttcacaaaacataaatcttccttaccattgaatgataaggtttcagtaaaatatcctaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38695917 |
gaatcttggcaattgtccgaatgtataagttatataggttgttcacaaaacataaatcttccttaccattgaatgataaggtttcagtaaaatatcctaa |
38696016 |
T |
 |
| Q |
218 |
acccagcacactggnnnnnnnctccatctttttcctcattcccctgttcatct |
270 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38696017 |
acccagcacactggtttttttctccatctttttcctcattcccctgttcatct |
38696069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University