View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_38 (Length: 257)
Name: NF10831_low_38
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 113 - 250
Target Start/End: Complemental strand, 47424335 - 47424198
Alignment:
| Q |
113 |
accttatattgtacaataacggttaaattttgatagattgttctccaaatgtgattttaaacgatattgttggannnnnnnagtgataataagtcaagtc |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| ||| |||||||| ||||||||||||||||||| |
|
|
| T |
47424335 |
accttatattgtacaataatggttaaattttgatagattgttctccaaatatgattttaaatgattttgttggatttttttagtgataataagtcaagtc |
47424236 |
T |
|
| Q |
213 |
ttaccataagagttttgtaaaaattctttttactcata |
250 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
47424235 |
ttactatacgagttttgtaaaaattctttttactcata |
47424198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 45
Target Start/End: Complemental strand, 47424438 - 47424403
Alignment:
| Q |
10 |
agatgaaagtatagggatggatgtaattaggaagta |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47424438 |
agatgaaagtatagggatggatgtaattaggaagta |
47424403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University