View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_42 (Length: 253)
Name: NF10831_low_42
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_42 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 53462872 - 53462620
Alignment:
| Q |
1 |
gagagccacgtgtcggcacattggagatgaaaagcgtggttacaaccgggtaacagacgagccggttgttcatcaacgatatcgtcaaggcaaacggcgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53462872 |
gagagccacgtgtcggcacattggagatgaaaagcgtggttacaaccgggtaacagacgagccggttgttcatcaacgatatcgtcaaggcaaacggcgc |
53462773 |
T |
|
| Q |
101 |
attcggtgggcgcgagcaattccttaccggtgattttaggaagcttttcaagatctaaaggggagagacccttttcggtgaccggcttcaacggtggatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53462772 |
attcggtgggcgcgagcaattccttaccggtgattttaggaagcttttcaagatctaaaggggagagacccttttcggtgaccggcttcaacggtggatt |
53462673 |
T |
|
| Q |
201 |
tgaatctgaacggtgacgagtggtggcgtagagaaggcacatgtagacgacga |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53462672 |
tgaatctgaacggtgacgagtggtggcgtagagaaggcacatgtagacgacga |
53462620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University