View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_45 (Length: 251)
Name: NF10831_low_45
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 28 - 240
Target Start/End: Complemental strand, 1359149 - 1358937
Alignment:
| Q |
28 |
tctcatagcatatagactctagtatcttggtttgtaactatcacttgtaaattttaccatcgacgcactcaatcaatcaaacgacttattttatgtttat |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1359149 |
tctcatagcatatagactctagtatcttggtttgtaactatcacttgtaaattttaccatcgacacactcaatcaatcaaacaacttattttatgtttat |
1359050 |
T |
 |
| Q |
128 |
atgcctctaacattttacttatatttttcttcgcatttttgttcttaaaattatttaccccatttaatactctttgaagtagttaaagaactcgtagcat |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1359049 |
atgcctctaacattttacttatatttttcttcgcattttagttcttaaaattatttaccccatttaatactctttgaagtagttaaaggactcgtagcat |
1358950 |
T |
 |
| Q |
228 |
tgacccagttctt |
240 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
1358949 |
tgacgcagttctt |
1358937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University