View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_51 (Length: 243)
Name: NF10831_low_51
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 56 - 204
Target Start/End: Original strand, 1359268 - 1359411
Alignment:
| Q |
56 |
tagtgccctcatcgttactcgactatataaactatagtcacatgatcgtgtgcatgccatgcttcctnnnnnnnttgttgtggggattatcccttatttt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
1359268 |
tagtgccctcatcgttactcgactatataaactatagtcacatgatcgtgtgcatgc-----ttcctaaaaaaattgttgtggggattatcccttatttt |
1359362 |
T |
 |
| Q |
156 |
cttaaataaataaatttaatgacaagaagtggacgatattaagtcctct |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1359363 |
cttaaataaataaatttaatgacaagaagtggacgatattaagtcctct |
1359411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 1359216 - 1359253
Alignment:
| Q |
1 |
tgatcttgaccaactaaaatagtgccctcatttctctc |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1359216 |
tgatcttgaccaactaaaatagtgccctcatttctctc |
1359253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University