View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_55 (Length: 240)
Name: NF10831_low_55
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 22432375 - 22432599
Alignment:
| Q |
1 |
tatgttcattggatgatcaatgagttgtgatggagacgatattcattaatcatctactaaac--gatgaaccacacatctaaattattatcgaattttga |
98 |
Q |
| |
|
||||| ||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||| |||| |||||||| || |
|
|
| T |
22432375 |
tatgtccattggacgattaatgagttgtgatgcagacgatattcattaatcatctactaaacacgattaaccacacatctaaaatattgtcgaatttcga |
22432474 |
T |
|
| Q |
99 |
tatcaaattgtttgagttttctctaaataaaatgttgcatatgaaattaaccggtcaaaattgaaacttcatattgaaggaaggggtcccattcccttga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22432475 |
tatcaaattgtttgagttttctctaaataaaatgttgcatatgaaattaaccggtcaaaattgaaacttcatattgaaggaaggggtcccattcccttga |
22432574 |
T |
|
| Q |
199 |
gactaattttgcttttggtcataat |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
22432575 |
gactaattttgcttttggtcataat |
22432599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University