View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_56 (Length: 239)
Name: NF10831_low_56
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 22 - 218
Target Start/End: Complemental strand, 41548565 - 41548369
Alignment:
| Q |
22 |
taagatctgggaacataaatgccaacatagccaacccccacaacaaagaaggcaatagattgcaggaaaagatatatatagcactgattcttcccaaagg |
121 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41548565 |
taagatctgggaacatagatgccaacatagccaacccccacaacaaagaaggcaatagattgcaggaaaagatatatatagcactgattcttcccaaagg |
41548466 |
T |
 |
| Q |
122 |
caagatcgtagcatccacacaaaaagagataggctcccacaccaagttctaggaaatgaatcctgttttaacatcaacaaacaagtagaaaagtgag |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41548465 |
caagatcgtagcatccacacaaaaagagataggctcccacaccaagttctaggaaatgaatcctgttttaacatcaacaaacaagtagaaaagtgag |
41548369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University