View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_60 (Length: 238)
Name: NF10831_low_60
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_60 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 7952498 - 7952649
Alignment:
| Q |
1 |
ttgaccaatccacccatgagaaagcaaaacaattgaagtcagttatagctatctagctttgtcagcaaaacatgatcaaattcatgatcaacatgcacca |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7952498 |
ttgaccaatccatccatgagaaagcaaaacaattgaagtcagttatagctatctagctttgtcagcaaaacatgatcaaattcatgatcaacatgcacca |
7952597 |
T |
 |
| Q |
101 |
caattgtagaactcaaccagctcagccatggaccccaattgtgtctcacctt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7952598 |
caattgtagaactcaaccagctcagccatggaccccaattgtgtctcacctt |
7952649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 25 - 152
Target Start/End: Original strand, 7936585 - 7936715
Alignment:
| Q |
25 |
caaaacaattgaagtcagt---tatagctatctagctttgtcagcaaaacatgatcaaattcatgatcaacatgcaccacaattgtagaactcaaccagc |
121 |
Q |
| |
|
||||||||||||||||||| |||||||||| || | | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7936585 |
caaaacaattgaagtcagtcactatagctatcaagttgtattagcaaaacatgatcaaattcatgatcaacatgcaccacaattgtagaactcaaccagc |
7936684 |
T |
 |
| Q |
122 |
tcagccatggaccccaattgtgtctcacctt |
152 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |
|
|
| T |
7936685 |
tcagccatggaccccaactgtgtctcacctt |
7936715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University