View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_63 (Length: 232)
Name: NF10831_low_63
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 32687141 - 32686925
Alignment:
| Q |
1 |
aactatgttgagcaagaatacatgataatccgagttaaaccaagtcgacaaattggttgaaccggccggctcaatccgacttttaaaacattgaattatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
32687141 |
aactatgttgagcaagaatacatgataatccgagtcaaaccaagtcgacaaattgattgaaccggccggctcaatccgatttttcaaacattgaattatt |
32687042 |
T |
 |
| Q |
101 |
tccaaccgtacaacatcatttagttgtcaatttcaaaccatgtgcataagtagtcctttagatggtctcaatcaaaacccaaaagaaataaaataaaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32687041 |
tccaaccgtacaacatcatttagttgtcaatttcaaaccatgtgcataagtagtcctttagatggtctcaatcaaaacccaaaagaaataaaataaaaca |
32686942 |
T |
 |
| Q |
201 |
gctcgcatggccctatg |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32686941 |
gctcgcatggccctatg |
32686925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University