View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10831_low_70 (Length: 220)

Name: NF10831_low_70
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10831_low_70
NF10831_low_70
[»] chr1 (1 HSPs)
chr1 (1-203)||(26348856-26349058)


Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 26348856 - 26349058
Alignment:
1 acaaatactatcaaaagagaatcttttgaaaacatcttgcaaatcaaaaacaacttggtttaggttttggttttggagtagagggatgagtcgattttcg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26348856 acaaatactatcaaaagagaatcttttgaaaacatcttgcaaatcaaaaacaacttggtttaggttttggttttggagtagagggatgagtcgattttcg 26348955  T
101 atttcgttgttgacaacttcaaaggcaaatgatcttacggattgtttgttgagttctaaacttgccatcttcttttgaaatttccataaatcaccatcca 200  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26348956 atttcgttgttgacaacttcaaaggcaaatgatcttatggattgtttgttgagttctaaacttgccatcttcttttgaaatttccataaatcaccatcca 26349055  T
201 cgt 203  Q
    |||    
26349056 cgt 26349058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University