View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_71 (Length: 218)
Name: NF10831_low_71
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_71 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 46287810 - 46288009
Alignment:
| Q |
1 |
tttccttgccggaggattgtgtttctgcaatattgtcacatacatcaccacaagatgcatgtagatttttattggtttccaacacttttgtcaaagttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46287810 |
tttccttgccggaggattgtgtttctgcaatattatcacatacatcaccacaagatgcatgtagatttttattggtttccaacacttttgtcaaagttgc |
46287909 |
T |
|
| Q |
101 |
agattctgacttggtttggaagacctttttaccctctgattatgaggacattgtctcaagagctgtgaatcaattctctttcaaattcatctcttcatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46287910 |
agattctgacttggtttggaagacctttttaccctctgattacgaggacattgtctcaagagctgtgaatcaattctctttcaaattcatctcttcatac |
46288009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University