View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_74 (Length: 212)
Name: NF10831_low_74
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_74 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 23 - 198
Target Start/End: Original strand, 31246119 - 31246294
Alignment:
| Q |
23 |
aaccttgaagccatagttctacggcgttacccagaaaatattgaagaaatacaggagatgacaacattgagggctgaagctttagcacaaatgggtcgcc |
122 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
31246119 |
aaccttgaagccatagttctgaggcgttatccagaaaatattgaagaaatacaggggatgacaacattgagaactgaagctttagcacaaatgagtcgcc |
31246218 |
T |
|
| Q |
123 |
ttaaattgctcatcctgtggaatttgaatttttcaggaaatctcaattttctttctagtcatttggggtatctctg |
198 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31246219 |
ttaaattgctcatgctgtggaatttgaatttctcaggaagtctcaattttctttctagtcatttggggtatctctg |
31246294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 80 - 195
Target Start/End: Original strand, 13610230 - 13610345
Alignment:
| Q |
80 |
atgacaacattgagggctgaagctttagcacaaatgggtcgccttaaattgctcatcctgtggaatttgaatttttcaggaaatctcaattttctttcta |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||| ||||||||||||||||| ||| | |||||||||| ||||||| ||||||||||||||| | |
|
|
| T |
13610230 |
atgacaacattgagggctgaagctttagcaaagatgactcgccttaaattgctcaagctgcgtgatttgaatttctcaggaagtctcaattttctttcaa |
13610329 |
T |
|
| Q |
180 |
gtcatttggggtatct |
195 |
Q |
| |
|
|| | ||||||||||| |
|
|
| T |
13610330 |
gtgaattggggtatct |
13610345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University