View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_75 (Length: 204)
Name: NF10831_low_75
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_75 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 75 - 188
Target Start/End: Original strand, 1218308 - 1218421
Alignment:
| Q |
75 |
caaatttcacattggatctcttaatatttaatccaaagttctttcctttttattgttattagaatctaagaattgttttttccctttatagaaaacaccc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1218308 |
caaatttcacattggatctcttaatatttaatcaaaagttctttcctttttactgttattagaatctaagaattgttttttcccttcatagaaaacacca |
1218407 |
T |
 |
| Q |
175 |
atcattggtttctt |
188 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1218408 |
atcattggtttctt |
1218421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University