View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10831_low_75 (Length: 204)

Name: NF10831_low_75
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10831_low_75
NF10831_low_75
[»] chr4 (1 HSPs)
chr4 (75-188)||(1218308-1218421)


Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 75 - 188
Target Start/End: Original strand, 1218308 - 1218421
Alignment:
75 caaatttcacattggatctcttaatatttaatccaaagttctttcctttttattgttattagaatctaagaattgttttttccctttatagaaaacaccc 174  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||     
1218308 caaatttcacattggatctcttaatatttaatcaaaagttctttcctttttactgttattagaatctaagaattgttttttcccttcatagaaaacacca 1218407  T
175 atcattggtttctt 188  Q
    ||||||||||||||    
1218408 atcattggtttctt 1218421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University