View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10831_low_77 (Length: 201)
Name: NF10831_low_77
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10831_low_77 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 38090416 - 38090228
Alignment:
| Q |
1 |
tctctcttgcttctctgtgctcccttgatatctattttccccaacagctcaacaaa-tccaattttgccattaatgtattattccttgggctattattat |
99 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38090416 |
tctctcttgcttctctgtgctcccttaatatctattttcctcaacagctcaacaaaatccaattttgccattaatgtattattccttgggctattattat |
38090317 |
T |
 |
| Q |
100 |
ggataattggatcataacattactcttgattgaagcaaacctaaatatccgcggttttggtaatacatacactaaatccgcagttctct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38090316 |
ggataattggatcataacattactcttgattgaagcaaacctaaatatccgcggttttggtaatacagacactaaatccgcagttctct |
38090228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University