View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10833_5 (Length: 355)
Name: NF10833_5
Description: NF10833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10833_5 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] scaffold0202 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 109 - 355
Target Start/End: Original strand, 31095293 - 31095539
Alignment:
| Q |
109 |
aaaactactcaaacacctgcgcaccaaaggtggcttcacatgttccctggctttgattttgtgattgaatataaacccgacagcgacaatatagcatctg |
208 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
31095293 |
aaaactactcaaacacctgcgcaacaaaggtggcttcacatgttacctggctttgattttgtgattgaatataaacccgacagagacaatatagcatccg |
31095392 |
T |
|
| Q |
209 |
attatgtatccctctcattcatgatggccttttcaaactagcaatctctattgctgcaacaaatgcatcaggctattgctgctaatgttaatttatcttc |
308 |
Q |
| |
|
||| |||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
31095393 |
attctgtatcccgctcattcatgatggctttttcaaactaacaatctctattgctgcaacaaatgcatcaggccattgctgctgatgttaatttatcttc |
31095492 |
T |
|
| Q |
309 |
tttaaagacacaatgtgcagatggtacacaacttgatccacattatc |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31095493 |
tttaaagacacaatgtgcagatggtacacaacttgattcacattatc |
31095539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0202 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: scaffold0202
Description:
Target: scaffold0202; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 116 - 355
Target Start/End: Original strand, 4025 - 4264
Alignment:
| Q |
116 |
ctcaaacacctgcgcaccaaaggtggcttcacatgttccctggctttgattttgtgattgaatataaacccgacagcgacaatatagcatctgattatgt |
215 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | | || ||||||| | |||| | | | | |
|
|
| T |
4025 |
ctcaaacacctaagcaacaaaggtggcttcacatgttccctggctttgattttgtgattgaatataaatctggcaaagacaatacaacatccgttgcttt |
4124 |
T |
|
| Q |
216 |
atccctctcattcatgatggccttttcaaactagcaatctctattgctgcaacaaatgcatcaggctattgctgctaatgttaatttatcttctttaaag |
315 |
Q |
| |
|
||||| ||||||||||||||| || |||||| || ||||||| ||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
4125 |
atcccgctcattcatgatggctttctcaaaccagaaatctctgttgctgcaacaaatgcatctggccattgctgctgatgttaatttatcttctttaaag |
4224 |
T |
|
| Q |
316 |
acacaatgtgcagatggtacacaacttgatccacattatc |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4225 |
acacaatgtgcagatggtacacaacttgatccacgttatc |
4264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University