View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10833_6 (Length: 346)
Name: NF10833_6
Description: NF10833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10833_6 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 28 - 346
Target Start/End: Original strand, 18237147 - 18237465
Alignment:
| Q |
28 |
actttctacggtactcgtacaaaggacacggtctaaaggagtttacaaagagatacctaaacaaagcaataaagttgatttgagttggaattcaaccgca |
127 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18237147 |
actttctacagtactcatacaaaggacacggtctaaaggagtttacaaatagatacctaaacaaagcaataaggttgatttgagttggaattcaaccgca |
18237246 |
T |
 |
| Q |
128 |
acactaaaatcattatccagaacaagcaacccctcagtaacccacaccttcctcttctggcttccacaaccacttatcatcgtcttccctcaatgacaac |
227 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18237247 |
gtactaaaatcattatccaaaacaagcaacccctcagtaacccacaccttcctcttccggcttccacaaccacttatcatcgtcttccctcaatgacaac |
18237346 |
T |
 |
| Q |
228 |
gagcacagttctacaccatgacaacgcccaacttcactcttcaccatgtccaacccttaattccctaaagctagcatcttggaatagagaacaaccgcgg |
327 |
Q |
| |
|
||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18237347 |
gagcaaacttctacaccatgacaacgcccaacttcactcttcaccatgtccaacccttaattccctaaagttagcatcttggaatagagaacaaccgcgg |
18237446 |
T |
 |
| Q |
328 |
aaattgctcacacaaggga |
346 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
18237447 |
aaattgctcacacaaggga |
18237465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University