View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10834_high_7 (Length: 224)
Name: NF10834_high_7
Description: NF10834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10834_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 18 - 153
Target Start/End: Original strand, 51720315 - 51720454
Alignment:
| Q |
18 |
aaaagtatgatatggtttacacaacaacttgaatatattataggtgtgtatttgataatgatcctacatatgatgaatatattattg----gtgtgttct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51720315 |
aaaagtatgatatggtttacacaacaacttgaatatattataggtgtgtatttgataatgatcctacatatgatgaatatattattggtgtgtgtgttct |
51720414 |
T |
 |
| Q |
114 |
cctcttaaaaaagaaattatattataggtgtgtgtatatt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51720415 |
cctcttaaaaaagaaattatattataggtgtgtgtatatt |
51720454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University