View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10834_high_8 (Length: 223)
Name: NF10834_high_8
Description: NF10834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10834_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 207
Target Start/End: Original strand, 7948406 - 7948594
Alignment:
| Q |
19 |
agaaacttggtctcctttcaaaagcagaagaacttggtgtcttatcagctgctactgatccatcaactccaggatcactcttcacactcagctttgtttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7948406 |
agaaacttggtctcctttcaaaagcagaagaacttggtgttttatcagctgctactgatccatcaactccaggatcactcttcacactcagctttgtttt |
7948505 |
T |
 |
| Q |
119 |
gcttcttttaggtcctttgtttgtttatcttgttcccgaagataatgttgtcgaggttggattgcaggctgtggttgctttgatctgtg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7948506 |
gcttcttttaggtcctttgtttgtttatcttgttcccgaagataatgttgtcgaggttggattgcaggctgtggttgctttgatctgtg |
7948594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University