View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10834_high_9 (Length: 217)
Name: NF10834_high_9
Description: NF10834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10834_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 25671233 - 25671034
Alignment:
| Q |
1 |
attacaagaatggtgttgatattgaaacacctatggaagaaccnnnnnnncctatggcttcacttgtttattttcagtttacttttgctgctattactat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25671233 |
attacaagaatggtgttgatattgaaacacctatggaagaacctttttttcctatggcttcacttgtttattttcagtttacttttgctgctattactat |
25671134 |
T |
 |
| Q |
101 |
gattttgttggctggttctgttcttggaagaatgaatattaaagcttggatggcttttgttcctctttggcttattttttcttatactgttggtgctttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25671133 |
gattttgttggctggttctgttcttggaagaatgaatattaaagcttggatggcttttgttcctctttggcttattttttcttatactgttggtgctttt |
25671034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 51 - 200
Target Start/End: Complemental strand, 5625394 - 5625245
Alignment:
| Q |
51 |
cctatggcttcacttgtttattttcagtttacttttgctgctattactatgattttgttggctggttctgttcttggaagaatgaatattaaagcttgga |
150 |
Q |
| |
|
|||||||||||||||||||||||||| || | |||||||||||||||| | |||||||| ||||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
5625394 |
cctatggcttcacttgtttattttcaattcaattttgctgctattactgttattttgttagctggatctgttcttggaagaatgaacattagggcttgga |
5625295 |
T |
 |
| Q |
151 |
tggcttttgttcctctttggcttattttttcttatactgttggtgctttt |
200 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
5625294 |
tggcttttgtacctctttggctcattttctcttacactgttggtgctttt |
5625245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 200
Target Start/End: Complemental strand, 39726590 - 39726498
Alignment:
| Q |
108 |
ttggctggttctgttcttggaagaatgaatattaaagcttggatggcttttgttcctctttggcttattttttcttatactgttggtgctttt |
200 |
Q |
| |
|
||||||||||||||| | | || |||||| |||| ||||||||| ||||| || |||||| | | ||||||||||||| ||||||||||| |
|
|
| T |
39726590 |
ttggctggttctgttttggctaggatgaattttaaggcttggatgatgtttgtgccactttggttaactttttcttatactattggtgctttt |
39726498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University