View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10834_low_3 (Length: 362)
Name: NF10834_low_3
Description: NF10834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10834_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 20 - 353
Target Start/End: Complemental strand, 8339330 - 8338997
Alignment:
| Q |
20 |
agcacgaacccaagtctctaccgaatattcacgaaacttatcgtccgagaaggaatgaacacagctgagactcatcttctgaatggcacggggattacgt |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8339330 |
agcacgaacccaagtctctacggaatattcacgaaacttatcgtccgtgaaggaatgaacacagctgagactcatcttctgaatggcacggggattacgt |
8339231 |
T |
|
| Q |
120 |
aggagagccaggacaacgttaactagaagagcgaaactcttgaaacgctccgctggttggtcgacatactcatgggagtcatcggagaagtgaagaacgg |
219 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8339230 |
aggagagccaggacaccgttaactagaagagcgaaactcttgaaacgctccgctggttggtcgacatactcatgggagtcatcggagaagtgaagaacgg |
8339131 |
T |
|
| Q |
220 |
agagatgctgccagaggtggcgccaccggctagaaaggcgagcggtggaaactgaggtttttgtagggaggaatgagaggatatggttcaaaacaccgtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8339130 |
agagatgctgccagaggtggcgccaccggctagaaagtcgagcggtggaaactgaggtttttgtagggaggaatgaaaggatatggttcaaaacaccgtc |
8339031 |
T |
|
| Q |
320 |
cggtaagtagctgattctgtcttcgttttcttct |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8339030 |
gggtaagtagctgattctgtcttcgttttcttct |
8338997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 95 - 163
Target Start/End: Complemental strand, 4453849 - 4453781
Alignment:
| Q |
95 |
cttctgaatggcacggggattacgtaggagagccaggacaacgttaactagaagagcgaaactcttgaa |
163 |
Q |
| |
|
|||| ||||||| ||||||||||| |||||||| || ||| | ||||||| ||||||||| ||| |||| |
|
|
| T |
4453849 |
cttccgaatggcgcggggattacggaggagagcaagcacaccattaactaaaagagcgaagctcctgaa |
4453781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University