View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10834_low_9 (Length: 242)
Name: NF10834_low_9
Description: NF10834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10834_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 43669533 - 43669759
Alignment:
| Q |
1 |
tacaaagacttggttcaaattggtggtttactcattgatgtatacgtgactgttccattaagaaatttaaatggattgatcttaatcggatacccttaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43669533 |
tacaaagacttggttcaaattggtggtttactcattgatgtatatgtgactgttccattaagaaatttaaatggattgatcttaatcggatacccttaaa |
43669632 |
T |
|
| Q |
101 |
tgtaccgaccatgttttgcatccaattcattcagatcccaagttgtcttgcnnnnnnnnnnnnncacattataatgattgcatatttatggttaagcatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43669633 |
tgtaccgaccatgttttgcatccaattcattcagatcccaagttgtcttgcaaaaatgaaaaaacacattataatgattgcatatttatggttaagcatt |
43669732 |
T |
|
| Q |
201 |
gcatgatgatttagtactatcatattt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43669733 |
gcatgatgatttagtactatcatattt |
43669759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University