View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10835_low_14 (Length: 272)
Name: NF10835_low_14
Description: NF10835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10835_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 263
Target Start/End: Complemental strand, 32167220 - 32166976
Alignment:
| Q |
19 |
ggtatgactttcggagatgaagcgtagattgaccgggagtttggcaaaactactatgattttgtgaagttttaaagtgtagtttttgctaaaattatggt |
118 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||| ||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32167220 |
ggtatgacttttggagatgaagcatagattgactgggagttcggcaaaacaactataattttgtgaagttttaaagtgtagtttttgctaaaattacggt |
32167121 |
T |
|
| Q |
119 |
ggtttatttattatgtcaatctcaccgtcaatccaacatgtacaaagagatatgtaaaacttatttgatatttaaattaataaaaacgtaaactgattga |
218 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
32167120 |
gatttatttattatgtcaatctcaccgtcaatccaacatgcacaaagaaatatgtaaagtttatttgatacttaaattaataaaaaggtaaactgattga |
32167021 |
T |
|
| Q |
219 |
tatgcataaacaagacacgtttaagaacctcgataagaatatctg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32167020 |
tatgcataaacaagacacgtttaagaacctcaataagaatatctg |
32166976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 74 - 121
Target Start/End: Original strand, 9483656 - 9483704
Alignment:
| Q |
74 |
tgattttgt-gaagttttaaagtgtagtttttgctaaaattatggtggt |
121 |
Q |
| |
|
||||||||| ||||||||||||| |||||| ||| |||||||||||||| |
|
|
| T |
9483656 |
tgattttgttgaagttttaaagtctagtttctgccaaaattatggtggt |
9483704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 82 - 114
Target Start/End: Original strand, 22050290 - 22050322
Alignment:
| Q |
82 |
tgaagttttaaagtgtagtttttgctaaaatta |
114 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
22050290 |
tgaagctttaaagtgtagtttttgctaaaatta |
22050322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 74 - 113
Target Start/End: Original strand, 38493980 - 38494020
Alignment:
| Q |
74 |
tgattttgt-gaagttttaaagtgtagtttttgctaaaatt |
113 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
38493980 |
tgattttgttgaagttttaaagtgtagcttttgctaaaatt |
38494020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University