View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10835_low_19 (Length: 241)
Name: NF10835_low_19
Description: NF10835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10835_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 24 - 224
Target Start/End: Complemental strand, 36621532 - 36621332
Alignment:
| Q |
24 |
agtgaaagataattacccatcaaattgttggaaattgtttaatgtattcattcattagaagttcataaattagaccctctaatctgggtttcactcctcc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36621532 |
agtgaaagataattacccatcaaattgttggaaattgtttaatgtattcatttattagaagttcataaactagaccctctaatctgggtttcactcctcc |
36621433 |
T |
|
| Q |
124 |
acctgagcttgtaataagagaaaccaatatagaaatataaaagaagacgaggtatagtctttgttcatacagttcggtcaatgatctctgcaactatagt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36621432 |
acctgagcttgtaataagagaaaccaatataaaaatataaaagaagatgaggtatagtctttgttcatacagttcggtcaatgatctctgcaactatagt |
36621333 |
T |
|
| Q |
224 |
t |
224 |
Q |
| |
|
| |
|
|
| T |
36621332 |
t |
36621332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University