View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10835_low_24 (Length: 237)
Name: NF10835_low_24
Description: NF10835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10835_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 41238046 - 41237824
Alignment:
| Q |
1 |
tctttgacgttgatgacgtgcaaaattaaacaatggtgtgacagtccatgcgagtttcaaatcacttccactttgaatctattgggaatgaattcaaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41238046 |
tctttgacgttgatgacgtgcaaaattaaacaatggtgtgtcagtccatgcgagttttaaatcacttccacattgaatctattgggaatgaattcaaaac |
41237947 |
T |
|
| Q |
101 |
gattgtactttgaacaactataaatgcaattatgttgtcaagggtttgaattgggaatttcctctgatcctagtttgataatgtttgttacccacttaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41237946 |
gattgtactttgaacaactataaatgcaattatgttgtcaagggtttgaattgggaatttcctctgatcctagtttgataatgtttgttacccacttaaa |
41237847 |
T |
|
| Q |
201 |
catgatatattcgtcgtcccttc |
223 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
41237846 |
catgatatattcgttgtcccttc |
41237824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University