View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10835_low_26 (Length: 227)
Name: NF10835_low_26
Description: NF10835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10835_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 41238297 - 41238094
Alignment:
| Q |
1 |
cacctcataaagcttcttttgatcggagatagtggtaagttactcctttgcctcttctttcttgttttctcatagtgaggccgatgtacttcagttttag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41238297 |
cacctcataaagcttcttttgatcggagatagtggtaagttactcctttgcctcttctttcttgttttctcatagtgaggccgatgtactttagttttag |
41238198 |
T |
|
| Q |
101 |
aattcaatttttcaatcatgtactttgatcaattataaatgcaatattttgtcaagggttttgacttttgaatttgtacattgatcaatctagtccctga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41238197 |
aattcaatttttcaatcatgtactttgatcaattataaatgcaatattttgtcaagggttttgacttttgaatttgtacattgatcaatctagtccctga |
41238098 |
T |
|
| Q |
201 |
attt |
204 |
Q |
| |
|
|||| |
|
|
| T |
41238097 |
attt |
41238094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 193 - 227
Target Start/End: Complemental strand, 41238076 - 41238042
Alignment:
| Q |
193 |
gtccctgaattttttgatacagcacaatagtcttt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41238076 |
gtccctgaattttttgatacagcacaatagtcttt |
41238042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University