View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10835_low_27 (Length: 227)
Name: NF10835_low_27
Description: NF10835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10835_low_27 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 227
Target Start/End: Original strand, 32596754 - 32596960
Alignment:
| Q |
20 |
cgttgttatattttgagttcgacttgaagaatacattgcaaaatatgtcaagtctactcaataccaagttggataatgtttgctggaaaccccattctac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32596754 |
cgttgttatattttgagttcgacttgaagaatacattgcaaaatatgtcatgtctactcaataccaagttggataatgtttgctggaaaccccattctac |
32596853 |
T |
|
| Q |
120 |
ggtctcaccctctctccttgtttagttgcttgaaagggtgtaaatgtagtctcagtctgtggtataaaatagtgtataaggtgtccaccctctctcctag |
219 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32596854 |
ggtctcaccctgtctccttgtttagttgcttg-aagggtgtaaatgtagtctcagtctgtggtataaaatagtgtatatggtgtccaccctctctcctag |
32596952 |
T |
|
| Q |
220 |
ttaaatgg |
227 |
Q |
| |
|
||| |||| |
|
|
| T |
32596953 |
ttacatgg |
32596960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 90
Target Start/End: Original strand, 32667147 - 32667189
Alignment:
| Q |
48 |
gaatacattgcaaaatatgtcaagtctactcaataccaagttg |
90 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||| |||||| |
|
|
| T |
32667147 |
gaatacattacaaaatatgtcaagtctacacaatacaaagttg |
32667189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University