View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10835_low_9 (Length: 310)
Name: NF10835_low_9
Description: NF10835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10835_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 225 - 292
Target Start/End: Complemental strand, 30326494 - 30326430
Alignment:
| Q |
225 |
ttgttttttgttctgtggtacgatatttgttgttagtgtaactactactccctacctatgattataaa |
292 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30326494 |
ttgttttttgttcagtggtacgatatttgttgttagtgtaac---tactccctacctatgattataaa |
30326430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University