View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10837_low_1 (Length: 400)
Name: NF10837_low_1
Description: NF10837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10837_low_1 |
 |  |
|
| [»] scaffold0229 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0229 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: scaffold0229
Description:
Target: scaffold0229; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 16768 - 16548
Alignment:
| Q |
1 |
atatataaattgtactcgaagagtgatgagaccctctttagctataattgcactattatgtagcaaaaattacacaacattaagcatgtaaagcatggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16768 |
atatataaattgtactcgaagagtgatgagaccctctttagctataattgcactattatgtagcaaaaattacacaacattaagcatgtaaagcatggta |
16669 |
T |
 |
| Q |
101 |
aaaactagaaaattattgaatgcaaattggttataactcttggtggtattttggggaaactcttaacaatcctcggacaccacaattgtgaaacataaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
16668 |
aaaactagaaaattattgaatgcaaattggttataactcttggtggtattttggggaaactcttaacaatcctcaaacatcacaattgtgaaacataaac |
16569 |
T |
 |
| Q |
201 |
aaagatgaacggaatgctgag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
16568 |
aaagatgaacggaatgctgag |
16548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0229; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 302 - 381
Target Start/End: Complemental strand, 16504 - 16425
Alignment:
| Q |
302 |
aatttttccattatcatattcagatgagaggcatgcttttcatcagacctggccattgttattttttgaggcaactatcc |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16504 |
aatttttccattatcatattcagatgagaggcatgcttttcatcagacctaaccattgttattttttgaggcaactatcc |
16425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 1401590 - 1401810
Alignment:
| Q |
1 |
atatataaattgtactcgaagagtgatgagaccctctttagctataattgcactattatgtagcaaaaattacacaacattaagcatgtaaagcatggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1401590 |
atatataaattgtactcgaagagtgatgagaccctctttagctataattgcactattatgtagcaaaaattacacaacattaagcatgtaaagcatggta |
1401689 |
T |
 |
| Q |
101 |
aaaactagaaaattattgaatgcaaattggttataactcttggtggtattttggggaaactcttaacaatcctcggacaccacaattgtgaaacataaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
1401690 |
aaaactagaaaattattgaatgcaaattggttataactcttggtggtattttggggaaactcttaacaatcctcaaacatcacaattgtgaaacataaac |
1401789 |
T |
 |
| Q |
201 |
aaagatgaacggaatgctgag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1401790 |
aaagatgaacggaatgctgag |
1401810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 302 - 381
Target Start/End: Original strand, 1401854 - 1401933
Alignment:
| Q |
302 |
aatttttccattatcatattcagatgagaggcatgcttttcatcagacctggccattgttattttttgaggcaactatcc |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1401854 |
aatttttccattatcatattcagatgagaggcatgcttttcatcagacctaaccattgttattttttgaggcaactatcc |
1401933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University