View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10837_low_2 (Length: 314)
Name: NF10837_low_2
Description: NF10837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10837_low_2 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 314
Target Start/End: Complemental strand, 39261628 - 39261322
Alignment:
| Q |
18 |
attccatcctttgaaattacaagatcaaattaattgacgttaaaacgacatcaaaaatcatattgaaacactcgaatccggttgcaaccttctaataaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39261628 |
attccatcctttgaaattacaagatcaaattaattgacgttaaaacgacatcaaaaatcattttgaaacactcgaatccggttgcaaccttctaataaag |
39261529 |
T |
|
| Q |
118 |
ctttgttcaactccactagaaatttttgttttagtcttattttgtattttagcaagtaaacatga----------nnnnnnnnnatgtagggtatgtgtt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39261528 |
ctttgttcaactccactagaaatttttgttttagtcttattttgtattttagcaagtaaacatgacatgtctttgattttttttatgtagggtatgtgtt |
39261429 |
T |
|
| Q |
208 |
tattaactctaacagtatcactaccaatgttgagaccaccaccatgtgctcaagggatagcagacaaggattgccaaaaagcttcatcgctacaaattgg |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39261428 |
tattaactctaacagtatcactaccaatgttgagaccaccagcatgtgctcaagggatagcagacaaggattgccaaaaagcttcatcgctacaaattgg |
39261329 |
T |
|
| Q |
308 |
tattttc |
314 |
Q |
| |
|
||||||| |
|
|
| T |
39261328 |
tattttc |
39261322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 196 - 314
Target Start/End: Complemental strand, 39251846 - 39251728
Alignment:
| Q |
196 |
agggtatgtgtttattaactctaacagtatcactaccaatgttgagaccaccaccatgtgctcaagggatagcagacaaggattgccaaaaagcttcatc |
295 |
Q |
| |
|
|||| ||||||||||| ||||| |||| |||||||||||| ||||||||||||| ||| |||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
39251846 |
agggaatgtgtttattgactcttgcagtgtcactaccaatgctgagaccaccaccttgttctcaagggatagaagacaatgattgccaaaaagcttcatc |
39251747 |
T |
|
| Q |
296 |
gctacaaattggtattttc |
314 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39251746 |
actacaaattggtattttc |
39251728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 193 - 314
Target Start/End: Complemental strand, 39245847 - 39245726
Alignment:
| Q |
193 |
tgtagggtatgtgtttattaactctaacagtatcactaccaatgttgagaccaccaccatgtgctcaagggatagcagacaaggattgccaaaaagcttc |
292 |
Q |
| |
|
||||||| ||||||||||| ||||| ||||||||||||||| | |||||||||||||||||||| |||||||| | | ||||||||||||||||||| |
|
|
| T |
39245847 |
tgtagggaatgtgtttattgactctttcagtatcactaccaacgctgagaccaccaccatgtgctgtagggatagaaaaacaggattgccaaaaagcttc |
39245748 |
T |
|
| Q |
293 |
atcgctacaaattggtattttc |
314 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
39245747 |
atcactacaaattggtattttc |
39245726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University