View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10838_high_16 (Length: 231)
Name: NF10838_high_16
Description: NF10838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10838_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 217
Target Start/End: Complemental strand, 295028 - 294824
Alignment:
| Q |
13 |
gcagagatgggagtttcttctttttggtggactcatatggatatacttaactgcaagaccaggtgttcttattggtgccattgatgcttacctttttgct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
295028 |
gcagagatgggagtttcttctttttggtggactcatatggatatacttaactgcaagaccaggtgttcttattggtgccattgatgcttacctttttgct |
294929 |
T |
|
| Q |
113 |
cctcttcaacttggttttgacaatctatctggaaggagaaatttgaagactggtgattttcttgttggagataaaatcggtgaagggtcatttggtgttg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
294928 |
cctcttcaacttggttttgacaatctatctggaaggagaaacttgaagactggtgattttcttgttggagataaaatcggtgaagggtcatttggtgttg |
294829 |
T |
|
| Q |
213 |
tttat |
217 |
Q |
| |
|
||||| |
|
|
| T |
294828 |
tttat |
294824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 60 - 217
Target Start/End: Original strand, 27490712 - 27490869
Alignment:
| Q |
60 |
taactgcaagaccaggtgttcttattggtgccattgatgcttacctttttgctcctcttcaacttggttttgacaatctatctggaaggagaaatttgaa |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||| ||||| | ||| ||| ||| || | | |||||||||||||||||||||| |
|
|
| T |
27490712 |
taactgcaagaccaggtgttcttattggtgctattgatgcataccttttggctccaatgcaatttgttttggatagtttatctggaaggagaaatttgaa |
27490811 |
T |
|
| Q |
160 |
gactggtgattttcttg-ttggagataaaatcggtgaagggtcatttggtgttgtttat |
217 |
Q |
| |
|
|| |||| ||||||| |||| | ||| || || |||||||||||||||||||||||| |
|
|
| T |
27490812 |
gaggagtga-tttcttgattggtggtaagataggagaagggtcatttggtgttgtttat |
27490869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University