View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10838_low_18 (Length: 306)
Name: NF10838_low_18
Description: NF10838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10838_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 11 - 290
Target Start/End: Original strand, 5229605 - 5229883
Alignment:
| Q |
11 |
cacagagccaaagatgttgttaatctttcaaagtcttatcttaattcttaaccagcaaagatgttaatttttcaagtcttgtcttaactcttaactacca |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5229605 |
cacaaagccaaagatgttgttaatctttcaaagtcttatcttaattcttaaccacaaaagatgttaatctttcaagtcttgtcttaactcttaactacca |
5229704 |
T |
|
| Q |
111 |
tcattggcatagtttaatcacaactaatgaaccaaacatatatactatatatgctttaacttcactcctactcnnnnnnnnnnnnnnnnnnnntcattaa |
210 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5229705 |
tcattggcatagtttaatcacaaccaatgaaccaaacatatatactatatatgctttaacttcactcctactc-aaaaaataaaaaaataaaatcattaa |
5229803 |
T |
|
| Q |
211 |
accctctcaacaattttatcatcattttgtttctcaatgcattaattcatactctttcttcacatctttaatcttcttcc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5229804 |
accctctcaacaattttatcatcattttgtttctcaatgcattaattcatactctttcttcacatctttaatcttcttcc |
5229883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University