View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10838_low_25 (Length: 254)
Name: NF10838_low_25
Description: NF10838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10838_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 40696253 - 40696037
Alignment:
| Q |
16 |
atgaagtagatggatcaagaagttgatggtctctgtatatgatggttcttacacggtagt-ggtagtggaagatcattaaattcagtggtctatgctaaa |
114 |
Q |
| |
|
|||||||| || ||| |||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40696253 |
atgaagtaaatagatgaagaagttgatggtct--gtatatgatggttcttagttcttacacggtagtggaagatcattaaattcagtggtctatgctaaa |
40696156 |
T |
|
| Q |
115 |
ataatattccaaaaatgggatcaaaaaataattatagattagatttgattaaaatattgttttacttacttggtttgccaagtggattagatgatagtgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40696155 |
ataatattccaaaaatgggatcaaaaaataattatagattagatttgattaaaatattgttttacttacttggtttgccaagtggattagatgatagtgg |
40696056 |
T |
|
| Q |
215 |
ccggctttgtttatctttt |
233 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40696055 |
ccggctttgtttatctttt |
40696037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University