View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10838_low_28 (Length: 250)
Name: NF10838_low_28
Description: NF10838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10838_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 27880807 - 27880563
Alignment:
| Q |
1 |
gtgtgcgtgtatggtacgcgcgttgaggagagtggtggttggagagttgagacattgggatacaatggattggaacattggaatgagacagtttttgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27880807 |
gtgtgcgtgtatggtacgcgcgttgaggagagtggtagttggagagttgagacattgggatacaatggattggaacattggaatgagacagtttttgatt |
27880708 |
T |
|
| Q |
101 |
ttgttttgaacaatgatgaatgttagcgttgttgtt------gttgaagtaggttatggttatggtgattgtgttgagggttttgggtttggaattagaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27880707 |
ttgttttgaacaatgatgaatgttagcgttgttgttgttgttgttgaagtaggttatggttatggtgattgtgttgagggttttgggtttggaattagaa |
27880608 |
T |
|
| Q |
195 |
acatagtcgttggtttgttctgtatttctttctgttccagttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27880607 |
acatagtcgttggtttgttctgtatttctttctgttccagttcat |
27880563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University